flag control Search Results


93
Sino Biological sema4c
<t>SEMA4C</t> is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).
Sema4c, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sema4c/product/Sino Biological
Average 93 stars, based on 1 article reviews
sema4c - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Sino Biological pcmv flag
<t>SEMA4C</t> is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).
Pcmv Flag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmv flag/product/Sino Biological
Average 93 stars, based on 1 article reviews
pcmv flag - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

93
Sino Biological pcmv3 n flag
<t>SEMA4C</t> is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).
Pcmv3 N Flag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcmv3 n flag/product/Sino Biological
Average 93 stars, based on 1 article reviews
pcmv3 n flag - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

90
Amgen epor positive control cell lysate flag-epor cos7
<t>SEMA4C</t> is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).
Epor Positive Control Cell Lysate Flag Epor Cos7, supplied by Amgen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/epor positive control cell lysate flag-epor cos7/product/Amgen
Average 90 stars, based on 1 article reviews
epor positive control cell lysate flag-epor cos7 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma dbp lentiviruses expressing the flag peptide (lv-flag-dbp and control lv-flag)
<t>DBP</t> regulated CCL2 expression via the target gene TRIM55. a siDBP inhibited TRIM55 mRNA expression, but not the expression of six other genes. b DBP bound to the TRIM55 promoter, as revealed by chromatin immunoprecipitation sequencing (ChIP)-PCR. c DBP bound to the TRIM55 promoter (-2984 bp), as revealed by the dual luciferase assay. d The TRIM55 promoter was divided into three subregions. e The dual luciferase assay indicated that DBP specifically bound to the -2116–2984-bp region. f, g: siTRIM55-1 and siTRIM55-2 significantly inhibited TNF-α and CCL2 expression at both the mRNA and protein levels in MCs. h The rescue assay showed that DBP-mediated CCL2 upregulation was blocked by si-TRIM55-1. si-TRIM55-1 and si-TRIM55-2, two siRNAs targeting TRIM55; Lv-Flag, <t>lentivirus</t> control; Lv-Flag-DBP: DBP-expressing lentivirus. *p < 0.05, **p < 0.01; n = 3. All assays were repeated at least three times
Dbp Lentiviruses Expressing The Flag Peptide (Lv Flag Dbp And Control Lv Flag), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dbp lentiviruses expressing the flag peptide (lv-flag-dbp and control lv-flag)/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
dbp lentiviruses expressing the flag peptide (lv-flag-dbp and control lv-flag) - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Obio Technology Corp Ltd overexpression plasmids for flag-tagged tmigd1, banf1, and their controls
<t>DBP</t> regulated CCL2 expression via the target gene TRIM55. a siDBP inhibited TRIM55 mRNA expression, but not the expression of six other genes. b DBP bound to the TRIM55 promoter, as revealed by chromatin immunoprecipitation sequencing (ChIP)-PCR. c DBP bound to the TRIM55 promoter (-2984 bp), as revealed by the dual luciferase assay. d The TRIM55 promoter was divided into three subregions. e The dual luciferase assay indicated that DBP specifically bound to the -2116–2984-bp region. f, g: siTRIM55-1 and siTRIM55-2 significantly inhibited TNF-α and CCL2 expression at both the mRNA and protein levels in MCs. h The rescue assay showed that DBP-mediated CCL2 upregulation was blocked by si-TRIM55-1. si-TRIM55-1 and si-TRIM55-2, two siRNAs targeting TRIM55; Lv-Flag, <t>lentivirus</t> control; Lv-Flag-DBP: DBP-expressing lentivirus. *p < 0.05, **p < 0.01; n = 3. All assays were repeated at least three times
Overexpression Plasmids For Flag Tagged Tmigd1, Banf1, And Their Controls, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/overexpression plasmids for flag-tagged tmigd1, banf1, and their controls/product/Obio Technology Corp Ltd
Average 90 stars, based on 1 article reviews
overexpression plasmids for flag-tagged tmigd1, banf1, and their controls - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sino Biological control plasmid pcmv-flag
<t>DBP</t> regulated CCL2 expression via the target gene TRIM55. a siDBP inhibited TRIM55 mRNA expression, but not the expression of six other genes. b DBP bound to the TRIM55 promoter, as revealed by chromatin immunoprecipitation sequencing (ChIP)-PCR. c DBP bound to the TRIM55 promoter (-2984 bp), as revealed by the dual luciferase assay. d The TRIM55 promoter was divided into three subregions. e The dual luciferase assay indicated that DBP specifically bound to the -2116–2984-bp region. f, g: siTRIM55-1 and siTRIM55-2 significantly inhibited TNF-α and CCL2 expression at both the mRNA and protein levels in MCs. h The rescue assay showed that DBP-mediated CCL2 upregulation was blocked by si-TRIM55-1. si-TRIM55-1 and si-TRIM55-2, two siRNAs targeting TRIM55; Lv-Flag, <t>lentivirus</t> control; Lv-Flag-DBP: DBP-expressing lentivirus. *p < 0.05, **p < 0.01; n = 3. All assays were repeated at least three times
Control Plasmid Pcmv Flag, supplied by Sino Biological, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control plasmid pcmv-flag/product/Sino Biological
Average 90 stars, based on 1 article reviews
control plasmid pcmv-flag - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Sangon Biotech gv141-flag control vector
<t>DBP</t> regulated CCL2 expression via the target gene TRIM55. a siDBP inhibited TRIM55 mRNA expression, but not the expression of six other genes. b DBP bound to the TRIM55 promoter, as revealed by chromatin immunoprecipitation sequencing (ChIP)-PCR. c DBP bound to the TRIM55 promoter (-2984 bp), as revealed by the dual luciferase assay. d The TRIM55 promoter was divided into three subregions. e The dual luciferase assay indicated that DBP specifically bound to the -2116–2984-bp region. f, g: siTRIM55-1 and siTRIM55-2 significantly inhibited TNF-α and CCL2 expression at both the mRNA and protein levels in MCs. h The rescue assay showed that DBP-mediated CCL2 upregulation was blocked by si-TRIM55-1. si-TRIM55-1 and si-TRIM55-2, two siRNAs targeting TRIM55; Lv-Flag, <t>lentivirus</t> control; Lv-Flag-DBP: DBP-expressing lentivirus. *p < 0.05, **p < 0.01; n = 3. All assays were repeated at least three times
Gv141 Flag Control Vector, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gv141-flag control vector/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
gv141-flag control vector - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Genechem tet-inducible flag-laptm5/control lentivirus
a Principal component analysis (PCA) of Renca luci parental and derivative cells. b Overlap of up-regulated genes in Renca LuM2b cells (LuM) as compared to Renca Parental (Par), Renca BrM2b (BrM) and Renca BoM2 (BoM) cells (left panel) and further overlap with up-regulated genes in RCC lung metastases (L-Mets) as compared with primary RCC without lung metastases (pri-RCC) in the Jon_Renal_Cancer dataset (right panel). c Heatmap showing the mRNA expression of Ctss , <t>Laptm5</t> and Igfbp5 in Renca luci parental and derivative cells measured by qRT-PCR, relative gene expression in each cell was compared with parental-1 (Par-1). d Immunoblotting (IB) analyses of LAPTM5 expression in Renca luci parental and derivative cells. e Immunohistochemistry (IHC) analysis of LAPTM5 staining in RCC in situ (renal subcapsular injection) and lung, bone, brain metastases. HE staining was used to show the site of bone metastasis. T, tumor. Scale bar, 200 μm. f IB analysis of control and Laptm5-overexpressing Renca luci cells or control and Laptm5-silenced Renca LuM2b cells. g Schematic illustration for intracardiac cell inoculation and metastasis detection. Representative bioluminescent images of lung metastases ( h ), brain and bone metastases ( i ) in mice treated as in ( g ) with Renca luci and derivatives. j Representative X-ray images of bone metastases in mice treated as in ( g ). k Quantification of photon flux changes of lung metastases in ( h ) ( n = 7 mice per group). l , m Representative bioluminescent images of lung metastases ( l ), brain and bone metastases ( m ) in mice treated as in ( g ) with Renca LuM2b and derivatives. n Representative X-ray images of bone metastases in mice treated as in ( g ). o Quantification of photon flux changes of lung metastases in (L) ( n = 7 mice per group). p Quantification of photon flux of brain and bone metastases at 15 days after I.C. inoculation with indicated cells ( n = 7 mice per group). Boxes represent data within the 25th to 75th percentiles, n.s., not significant. Immunoblots are representative of three biological replicates. In k and o , the data are presented as mean ± SEM, in ( p ), the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.
Tet Inducible Flag Laptm5/Control Lentivirus, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tet-inducible flag-laptm5/control lentivirus/product/Genechem
Average 90 stars, based on 1 article reviews
tet-inducible flag-laptm5/control lentivirus - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Genechem flag control plasmid
a Principal component analysis (PCA) of Renca luci parental and derivative cells. b Overlap of up-regulated genes in Renca LuM2b cells (LuM) as compared to Renca Parental (Par), Renca BrM2b (BrM) and Renca BoM2 (BoM) cells (left panel) and further overlap with up-regulated genes in RCC lung metastases (L-Mets) as compared with primary RCC without lung metastases (pri-RCC) in the Jon_Renal_Cancer dataset (right panel). c Heatmap showing the mRNA expression of Ctss , <t>Laptm5</t> and Igfbp5 in Renca luci parental and derivative cells measured by qRT-PCR, relative gene expression in each cell was compared with parental-1 (Par-1). d Immunoblotting (IB) analyses of LAPTM5 expression in Renca luci parental and derivative cells. e Immunohistochemistry (IHC) analysis of LAPTM5 staining in RCC in situ (renal subcapsular injection) and lung, bone, brain metastases. HE staining was used to show the site of bone metastasis. T, tumor. Scale bar, 200 μm. f IB analysis of control and Laptm5-overexpressing Renca luci cells or control and Laptm5-silenced Renca LuM2b cells. g Schematic illustration for intracardiac cell inoculation and metastasis detection. Representative bioluminescent images of lung metastases ( h ), brain and bone metastases ( i ) in mice treated as in ( g ) with Renca luci and derivatives. j Representative X-ray images of bone metastases in mice treated as in ( g ). k Quantification of photon flux changes of lung metastases in ( h ) ( n = 7 mice per group). l , m Representative bioluminescent images of lung metastases ( l ), brain and bone metastases ( m ) in mice treated as in ( g ) with Renca LuM2b and derivatives. n Representative X-ray images of bone metastases in mice treated as in ( g ). o Quantification of photon flux changes of lung metastases in (L) ( n = 7 mice per group). p Quantification of photon flux of brain and bone metastases at 15 days after I.C. inoculation with indicated cells ( n = 7 mice per group). Boxes represent data within the 25th to 75th percentiles, n.s., not significant. Immunoblots are representative of three biological replicates. In k and o , the data are presented as mean ± SEM, in ( p ), the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.
Flag Control Plasmid, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/flag control plasmid/product/Genechem
Average 90 stars, based on 1 article reviews
flag control plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
GM Biosciences Inc psg5-flag-gadd34/stop non-expressing control plasmid
a Principal component analysis (PCA) of Renca luci parental and derivative cells. b Overlap of up-regulated genes in Renca LuM2b cells (LuM) as compared to Renca Parental (Par), Renca BrM2b (BrM) and Renca BoM2 (BoM) cells (left panel) and further overlap with up-regulated genes in RCC lung metastases (L-Mets) as compared with primary RCC without lung metastases (pri-RCC) in the Jon_Renal_Cancer dataset (right panel). c Heatmap showing the mRNA expression of Ctss , <t>Laptm5</t> and Igfbp5 in Renca luci parental and derivative cells measured by qRT-PCR, relative gene expression in each cell was compared with parental-1 (Par-1). d Immunoblotting (IB) analyses of LAPTM5 expression in Renca luci parental and derivative cells. e Immunohistochemistry (IHC) analysis of LAPTM5 staining in RCC in situ (renal subcapsular injection) and lung, bone, brain metastases. HE staining was used to show the site of bone metastasis. T, tumor. Scale bar, 200 μm. f IB analysis of control and Laptm5-overexpressing Renca luci cells or control and Laptm5-silenced Renca LuM2b cells. g Schematic illustration for intracardiac cell inoculation and metastasis detection. Representative bioluminescent images of lung metastases ( h ), brain and bone metastases ( i ) in mice treated as in ( g ) with Renca luci and derivatives. j Representative X-ray images of bone metastases in mice treated as in ( g ). k Quantification of photon flux changes of lung metastases in ( h ) ( n = 7 mice per group). l , m Representative bioluminescent images of lung metastases ( l ), brain and bone metastases ( m ) in mice treated as in ( g ) with Renca LuM2b and derivatives. n Representative X-ray images of bone metastases in mice treated as in ( g ). o Quantification of photon flux changes of lung metastases in (L) ( n = 7 mice per group). p Quantification of photon flux of brain and bone metastases at 15 days after I.C. inoculation with indicated cells ( n = 7 mice per group). Boxes represent data within the 25th to 75th percentiles, n.s., not significant. Immunoblots are representative of three biological replicates. In k and o , the data are presented as mean ± SEM, in ( p ), the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.
Psg5 Flag Gadd34/Stop Non Expressing Control Plasmid, supplied by GM Biosciences Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/psg5-flag-gadd34/stop non-expressing control plasmid/product/GM Biosciences Inc
Average 90 stars, based on 1 article reviews
psg5-flag-gadd34/stop non-expressing control plasmid - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
PEPperPRINT gmbh internal controls mouse anti-flag cy3
a Principal component analysis (PCA) of Renca luci parental and derivative cells. b Overlap of up-regulated genes in Renca LuM2b cells (LuM) as compared to Renca Parental (Par), Renca BrM2b (BrM) and Renca BoM2 (BoM) cells (left panel) and further overlap with up-regulated genes in RCC lung metastases (L-Mets) as compared with primary RCC without lung metastases (pri-RCC) in the Jon_Renal_Cancer dataset (right panel). c Heatmap showing the mRNA expression of Ctss , <t>Laptm5</t> and Igfbp5 in Renca luci parental and derivative cells measured by qRT-PCR, relative gene expression in each cell was compared with parental-1 (Par-1). d Immunoblotting (IB) analyses of LAPTM5 expression in Renca luci parental and derivative cells. e Immunohistochemistry (IHC) analysis of LAPTM5 staining in RCC in situ (renal subcapsular injection) and lung, bone, brain metastases. HE staining was used to show the site of bone metastasis. T, tumor. Scale bar, 200 μm. f IB analysis of control and Laptm5-overexpressing Renca luci cells or control and Laptm5-silenced Renca LuM2b cells. g Schematic illustration for intracardiac cell inoculation and metastasis detection. Representative bioluminescent images of lung metastases ( h ), brain and bone metastases ( i ) in mice treated as in ( g ) with Renca luci and derivatives. j Representative X-ray images of bone metastases in mice treated as in ( g ). k Quantification of photon flux changes of lung metastases in ( h ) ( n = 7 mice per group). l , m Representative bioluminescent images of lung metastases ( l ), brain and bone metastases ( m ) in mice treated as in ( g ) with Renca LuM2b and derivatives. n Representative X-ray images of bone metastases in mice treated as in ( g ). o Quantification of photon flux changes of lung metastases in (L) ( n = 7 mice per group). p Quantification of photon flux of brain and bone metastases at 15 days after I.C. inoculation with indicated cells ( n = 7 mice per group). Boxes represent data within the 25th to 75th percentiles, n.s., not significant. Immunoblots are representative of three biological replicates. In k and o , the data are presented as mean ± SEM, in ( p ), the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.
Internal Controls Mouse Anti Flag Cy3, supplied by PEPperPRINT gmbh, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/internal controls mouse anti-flag cy3/product/PEPperPRINT gmbh
Average 90 stars, based on 1 article reviews
internal controls mouse anti-flag cy3 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


SEMA4C is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C is associated with decreased survival in colon cancer patients and is linked with increased invasiveness in colon cancer cells. Prognostic power of SEMA4C in colon cancer was analyzed with cancer multiomics database DriverDBv3 in terms of overall (A) and disease-free (B) survival. Peptide expression of SEMA4C in colon cancer and normal tissue (C) was analyzed with the mass spectrometry result from reference 36. Human colon cancer cell line HCT116 (D-H) and mouse colon cancer cell line CT26 (I-M) were treated with control IgG or SEMA4C antibody and analyzed with flow cytometry (D, I), antibody internalization assay (E, J), assays of proliferation (F, K), migration (G, L), and invasion (H, M).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Mass Spectrometry, Flow Cytometry, Migration

Ectopically expressed SEMA4C increases colon cancer motility. HCT116 (A, C, E, G) and SW480 (B, D, F, H) were transfected with control vector or SEMA4C-overexpressing plasmid, and analyzed for expression (A, B), proliferation (C, D), migration (E, F), and invasion (G, H).

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Ectopically expressed SEMA4C increases colon cancer motility. HCT116 (A, C, E, G) and SW480 (B, D, F, H) were transfected with control vector or SEMA4C-overexpressing plasmid, and analyzed for expression (A, B), proliferation (C, D), migration (E, F), and invasion (G, H).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Transfection, Plasmid Preparation, Expressing, Migration

RNA sequencing reveals the alteration of cell adhesion pathway in SEMA4C-overexpressing colon cancer cells. RNA sequencing results from TCGA colon cancer dataset (A, C) or the present study (B, D) were analyzed for SEMA4C-associated biological pathways (A, B) and gene sets (C, D). For validation, HCT116 (E, G) and CT26 (F) cells were subjected to SEMA4C blockage (E, F) or SEMA4C overexpression (G) and the results were analyzed for cell adhesion (E-G).

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: RNA sequencing reveals the alteration of cell adhesion pathway in SEMA4C-overexpressing colon cancer cells. RNA sequencing results from TCGA colon cancer dataset (A, C) or the present study (B, D) were analyzed for SEMA4C-associated biological pathways (A, B) and gene sets (C, D). For validation, HCT116 (E, G) and CT26 (F) cells were subjected to SEMA4C blockage (E, F) or SEMA4C overexpression (G) and the results were analyzed for cell adhesion (E-G).

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: RNA Sequencing Assay, Over Expression

SEMA4C affects tubulin acetylation via CRMP3. HCT116 (A, B, D, F-I) and CT26 (C, E) under the condition of SEMA4C blockage (A, B) or SEMA4C overexpression (C) were analyzed for alterations in total protein acetylation on lysine and tubulin acetylation. In addition, expressions of total tubulin and CRMP3 were also investigated. GAPDH served as internal control. Protein-protein interactions between SEMA4C and CRMP3 in HCT116 (D) and CT26 (E) were determined by immunoprecipitation of CRMP3 and subsequent Western blotting with human- or mouse-specific SEMA4C antibody as described. In functional validation, HCT116 cells were transfected with control vector or CRMP3-overexpressing plasmid and treated with control IgG or SEMA4C antibody (F, G) for cell migration (F) and invasion assays (G). On the other hand, HCT116 cells were transfected with control vector or SEMA4C-overexpressing plasmid, followed by transfection of shRNA against luciferase or against CRMP3 (H, I), with their effects on migration (H) and invasion (I) being analyzed as well.

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: SEMA4C affects tubulin acetylation via CRMP3. HCT116 (A, B, D, F-I) and CT26 (C, E) under the condition of SEMA4C blockage (A, B) or SEMA4C overexpression (C) were analyzed for alterations in total protein acetylation on lysine and tubulin acetylation. In addition, expressions of total tubulin and CRMP3 were also investigated. GAPDH served as internal control. Protein-protein interactions between SEMA4C and CRMP3 in HCT116 (D) and CT26 (E) were determined by immunoprecipitation of CRMP3 and subsequent Western blotting with human- or mouse-specific SEMA4C antibody as described. In functional validation, HCT116 cells were transfected with control vector or CRMP3-overexpressing plasmid and treated with control IgG or SEMA4C antibody (F, G) for cell migration (F) and invasion assays (G). On the other hand, HCT116 cells were transfected with control vector or SEMA4C-overexpressing plasmid, followed by transfection of shRNA against luciferase or against CRMP3 (H, I), with their effects on migration (H) and invasion (I) being analyzed as well.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Over Expression, Immunoprecipitation, Western Blot, Functional Assay, Transfection, Plasmid Preparation, Migration, shRNA, Luciferase

HDAC inhibitor Vorinostat inhibits SEMA4C-increased cell motility. TCGA colon cancer based- and L1000CDS2-predicted SEMA4C-counteracting therapeutics were shown (A) and HDAC inhibitor was selected for in vitro validation on proliferation (B), migration (C), and invasion (D) in HCT116.

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: HDAC inhibitor Vorinostat inhibits SEMA4C-increased cell motility. TCGA colon cancer based- and L1000CDS2-predicted SEMA4C-counteracting therapeutics were shown (A) and HDAC inhibitor was selected for in vitro validation on proliferation (B), migration (C), and invasion (D) in HCT116.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: In Vitro, Migration

Dual targeting of SEMA4C by neutralizing antibody and miRNA synergistically suppresses cell invasiveness. miRNAs targeting SEMA4C were identified by overlapping predicted miRNA from databases miRDB, TargetScan, and miRWalk, and the prognostic power of predictive miRNA let-7b (A) and its targeting onto SEMA4C 3’-UTR (B) were shown. Effect of let-7b mimic on proliferation in HCT116 was checked (C). Effects of dual targeting by neutralizing antibody and let-7b mimic on SEMA4C expression (D), migration (E), and invasion (F) in HCT116 were analyzed.

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Dual targeting of SEMA4C by neutralizing antibody and miRNA synergistically suppresses cell invasiveness. miRNAs targeting SEMA4C were identified by overlapping predicted miRNA from databases miRDB, TargetScan, and miRWalk, and the prognostic power of predictive miRNA let-7b (A) and its targeting onto SEMA4C 3’-UTR (B) were shown. Effect of let-7b mimic on proliferation in HCT116 was checked (C). Effects of dual targeting by neutralizing antibody and let-7b mimic on SEMA4C expression (D), migration (E), and invasion (F) in HCT116 were analyzed.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Expressing, Migration

Inhibition of SEMA4C reduces PD-L1 level in colon cancer cells. Correlation of PD-L1 (CD274) and SEMA4C in TCGA COAD dataset was shown (A). Effect of SEMA4C antibody blockage (B) or SEMA4C overexpression (C) on PD-L1 expression in HCT116 was analyzed by Western blotting.

Journal: American Journal of Cancer Research

Article Title: Semaphorin 4C promotes motility and immunosuppressive activity of cancer cells via CRMP3 and PD-L1

doi:

Figure Lengend Snippet: Inhibition of SEMA4C reduces PD-L1 level in colon cancer cells. Correlation of PD-L1 (CD274) and SEMA4C in TCGA COAD dataset was shown (A). Effect of SEMA4C antibody blockage (B) or SEMA4C overexpression (C) on PD-L1 expression in HCT116 was analyzed by Western blotting.

Article Snippet: Cell treatment and transfection For antibody blockage, cells were treated with 2 μg/ml rabbit control IgG or SEMA4C antibody for 24 h. For reagent treatment, cells were treated with histone deacetylase inhibitor Vorinostat (SAHA; MedChemExpress, Monmouth Junction, NJ, USA) at indicated concentrations for 24 h. For plasmid transfection, cells were transfected with 2 μg plasmid together with 3 μl HyFect transfection reagent (Leadgene) for 48 h. For miRNA transfection, cells were transfected with 200 nM negative control miRNA or let-7b mimic (GenePharma, Shanghai, China) together with 3 μl HyFect reagent for 48 h. SEMA4C-overexpressing plasmid (HG11955-CF), control vector (CV020), CRMP3-overexpressing plasmid (HG22668-UT), and untag vector (CV011) were from Sino Biological (Beijing, China). shRNAs were from RNAi core of Academia Sinica (Taipei, Taiwan) and the sequence was listed as below: sh-h-CRMP3, CCGGGAAGTTTCTCGAAGGTGCTTGCTCGAGCAAGCACCTTCGAGAAACTTCTTTTTG.

Techniques: Inhibition, Over Expression, Expressing, Western Blot

DBP regulated CCL2 expression via the target gene TRIM55. a siDBP inhibited TRIM55 mRNA expression, but not the expression of six other genes. b DBP bound to the TRIM55 promoter, as revealed by chromatin immunoprecipitation sequencing (ChIP)-PCR. c DBP bound to the TRIM55 promoter (-2984 bp), as revealed by the dual luciferase assay. d The TRIM55 promoter was divided into three subregions. e The dual luciferase assay indicated that DBP specifically bound to the -2116–2984-bp region. f, g: siTRIM55-1 and siTRIM55-2 significantly inhibited TNF-α and CCL2 expression at both the mRNA and protein levels in MCs. h The rescue assay showed that DBP-mediated CCL2 upregulation was blocked by si-TRIM55-1. si-TRIM55-1 and si-TRIM55-2, two siRNAs targeting TRIM55; Lv-Flag, lentivirus control; Lv-Flag-DBP: DBP-expressing lentivirus. *p < 0.05, **p < 0.01; n = 3. All assays were repeated at least three times

Journal: Cellular and Molecular Immunology

Article Title: The role of transcriptional factor D-site-binding protein in circadian CCL2 gene expression in anti-Thy1 nephritis

doi: 10.1038/s41423-018-0020-4

Figure Lengend Snippet: DBP regulated CCL2 expression via the target gene TRIM55. a siDBP inhibited TRIM55 mRNA expression, but not the expression of six other genes. b DBP bound to the TRIM55 promoter, as revealed by chromatin immunoprecipitation sequencing (ChIP)-PCR. c DBP bound to the TRIM55 promoter (-2984 bp), as revealed by the dual luciferase assay. d The TRIM55 promoter was divided into three subregions. e The dual luciferase assay indicated that DBP specifically bound to the -2116–2984-bp region. f, g: siTRIM55-1 and siTRIM55-2 significantly inhibited TNF-α and CCL2 expression at both the mRNA and protein levels in MCs. h The rescue assay showed that DBP-mediated CCL2 upregulation was blocked by si-TRIM55-1. si-TRIM55-1 and si-TRIM55-2, two siRNAs targeting TRIM55; Lv-Flag, lentivirus control; Lv-Flag-DBP: DBP-expressing lentivirus. *p < 0.05, **p < 0.01; n = 3. All assays were repeated at least three times

Article Snippet: DBP lentiviruses ( ≥ 1 × 10 9 TU/mL) expressing the Flag peptide (Lv-Flag-DBP and control Lv-Flag) were prepared by GenePharma.

Techniques: Expressing, ChIP-sequencing, Luciferase, Rescue Assay, Control

a Principal component analysis (PCA) of Renca luci parental and derivative cells. b Overlap of up-regulated genes in Renca LuM2b cells (LuM) as compared to Renca Parental (Par), Renca BrM2b (BrM) and Renca BoM2 (BoM) cells (left panel) and further overlap with up-regulated genes in RCC lung metastases (L-Mets) as compared with primary RCC without lung metastases (pri-RCC) in the Jon_Renal_Cancer dataset (right panel). c Heatmap showing the mRNA expression of Ctss , Laptm5 and Igfbp5 in Renca luci parental and derivative cells measured by qRT-PCR, relative gene expression in each cell was compared with parental-1 (Par-1). d Immunoblotting (IB) analyses of LAPTM5 expression in Renca luci parental and derivative cells. e Immunohistochemistry (IHC) analysis of LAPTM5 staining in RCC in situ (renal subcapsular injection) and lung, bone, brain metastases. HE staining was used to show the site of bone metastasis. T, tumor. Scale bar, 200 μm. f IB analysis of control and Laptm5-overexpressing Renca luci cells or control and Laptm5-silenced Renca LuM2b cells. g Schematic illustration for intracardiac cell inoculation and metastasis detection. Representative bioluminescent images of lung metastases ( h ), brain and bone metastases ( i ) in mice treated as in ( g ) with Renca luci and derivatives. j Representative X-ray images of bone metastases in mice treated as in ( g ). k Quantification of photon flux changes of lung metastases in ( h ) ( n = 7 mice per group). l , m Representative bioluminescent images of lung metastases ( l ), brain and bone metastases ( m ) in mice treated as in ( g ) with Renca LuM2b and derivatives. n Representative X-ray images of bone metastases in mice treated as in ( g ). o Quantification of photon flux changes of lung metastases in (L) ( n = 7 mice per group). p Quantification of photon flux of brain and bone metastases at 15 days after I.C. inoculation with indicated cells ( n = 7 mice per group). Boxes represent data within the 25th to 75th percentiles, n.s., not significant. Immunoblots are representative of three biological replicates. In k and o , the data are presented as mean ± SEM, in ( p ), the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a Principal component analysis (PCA) of Renca luci parental and derivative cells. b Overlap of up-regulated genes in Renca LuM2b cells (LuM) as compared to Renca Parental (Par), Renca BrM2b (BrM) and Renca BoM2 (BoM) cells (left panel) and further overlap with up-regulated genes in RCC lung metastases (L-Mets) as compared with primary RCC without lung metastases (pri-RCC) in the Jon_Renal_Cancer dataset (right panel). c Heatmap showing the mRNA expression of Ctss , Laptm5 and Igfbp5 in Renca luci parental and derivative cells measured by qRT-PCR, relative gene expression in each cell was compared with parental-1 (Par-1). d Immunoblotting (IB) analyses of LAPTM5 expression in Renca luci parental and derivative cells. e Immunohistochemistry (IHC) analysis of LAPTM5 staining in RCC in situ (renal subcapsular injection) and lung, bone, brain metastases. HE staining was used to show the site of bone metastasis. T, tumor. Scale bar, 200 μm. f IB analysis of control and Laptm5-overexpressing Renca luci cells or control and Laptm5-silenced Renca LuM2b cells. g Schematic illustration for intracardiac cell inoculation and metastasis detection. Representative bioluminescent images of lung metastases ( h ), brain and bone metastases ( i ) in mice treated as in ( g ) with Renca luci and derivatives. j Representative X-ray images of bone metastases in mice treated as in ( g ). k Quantification of photon flux changes of lung metastases in ( h ) ( n = 7 mice per group). l , m Representative bioluminescent images of lung metastases ( l ), brain and bone metastases ( m ) in mice treated as in ( g ) with Renca LuM2b and derivatives. n Representative X-ray images of bone metastases in mice treated as in ( g ). o Quantification of photon flux changes of lung metastases in (L) ( n = 7 mice per group). p Quantification of photon flux of brain and bone metastases at 15 days after I.C. inoculation with indicated cells ( n = 7 mice per group). Boxes represent data within the 25th to 75th percentiles, n.s., not significant. Immunoblots are representative of three biological replicates. In k and o , the data are presented as mean ± SEM, in ( p ), the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Immunohistochemistry, Staining, In Situ, Injection, Whisker Assay, Two Tailed Test

a Schematic illustration for the steps of cell inoculation and lung metastases detection. I.V., intravenous. b Representative IHC images of luciferase staining in lung sections harvested from mice treated as in ( a ). Scale bar, 50 μm. Quantification of micrometastasis (diameter < 100 μm, c ) and macrometastasis (diameter ≥ 100 μm, d ) per lung section in ( b ) ( n = 5 mice per group). Tumor sphere assay ( e ) and quantification of tumor sphere formation of indicated cells ( f , n = 3 per group). Scale bar, 200 μm. g Frequencies of tumors formation in indicated groups. Tumor volumes of control and Laptm5-overexpressing Renca cells ( h , n = 11 mice per group) or control and Laptm5-silenced Renca LuM2b cells ( i , n = 10 mice per group) inoculated subcutaneously with indicated cell number. j , k qRT-PCR analysis of stemness markers in control and LAPTM5-overexpressing Renca ( j ) and 786-O cells ( k ). n = 3 per group. In c , d , the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values, in ( e ), ( j ), and ( k ), the data are presents as mean ± SD, in ( h ) and ( i ), the data are presents as mean ± SEM. Two-tailed Student’s unpaired t -test was used for statistical analysis in ( c )–( e ), ( h )–( k ), χ test for ( g ). Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a Schematic illustration for the steps of cell inoculation and lung metastases detection. I.V., intravenous. b Representative IHC images of luciferase staining in lung sections harvested from mice treated as in ( a ). Scale bar, 50 μm. Quantification of micrometastasis (diameter < 100 μm, c ) and macrometastasis (diameter ≥ 100 μm, d ) per lung section in ( b ) ( n = 5 mice per group). Tumor sphere assay ( e ) and quantification of tumor sphere formation of indicated cells ( f , n = 3 per group). Scale bar, 200 μm. g Frequencies of tumors formation in indicated groups. Tumor volumes of control and Laptm5-overexpressing Renca cells ( h , n = 11 mice per group) or control and Laptm5-silenced Renca LuM2b cells ( i , n = 10 mice per group) inoculated subcutaneously with indicated cell number. j , k qRT-PCR analysis of stemness markers in control and LAPTM5-overexpressing Renca ( j ) and 786-O cells ( k ). n = 3 per group. In c , d , the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values, in ( e ), ( j ), and ( k ), the data are presents as mean ± SD, in ( h ) and ( i ), the data are presents as mean ± SEM. Two-tailed Student’s unpaired t -test was used for statistical analysis in ( c )–( e ), ( h )–( k ), χ test for ( g ). Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Luciferase, Staining, Quantitative RT-PCR, Whisker Assay, Two Tailed Test

a Differentially expressed cancer-related gene sets (C2_PATHWAYS) with high LAPTM5 expression in the TCGA KIRC cohort and KIRP cohort (Top 5). NES, normalized enrichment score. FDR q, false discovery rate q value. GSEA output of genes in the PID_BMP_Pathway by LAPTM5 high and low expression groups from the KIRC cohort ( b ) and KIRP cohort ( c ) in the TCGA database. ES, enrichment score. d IB analysis of Renca luci parental and derivative cells treated with Mock (ddH 2 O), or recombinant murine BMP4 (10 ng/mL or 20 ng/mL) for 60 min. e IHC analysis of p-Smad 1/5/8 levels in lung metastases of Renca luci . Scale bar, 50 μm. f IB analysis of control and Laptm5-overexpressing Renca cells (left panel) or control and Laptm5-silenced Renca LuM2b cells (middle and right panel) treated with BMP4 (10 ng/mL) for indicated times. g Representative images of tumor sphere assay of control and Laptm5-overexpressing Renca cells treated with or without BMP4 (30 ng/mL) for 7 days, and quantification of tumor sphere formation of indicated groups ( n = 3 per group). Scale bar, 200 μm. h Representative images of tumor sphere assay of control and Laptm5-silenced Renca LuM2b cells treated with or without DMH1 (5 μM) for 7 days, and quantification of tumor sphere formation of indicated groups ( n = 3 per group). Scale bar, 200 μm. i qRT-PCR analysis of stemness markers in indicated cells. n = 3 per group. j Semiquantitative RT-PCR analysis of BMP receptors in control and Laptm5-overexpressing Renca luci cells with Actb as control. k IB analysis of BMPR1A in control and Laptm5-overexpressing Renca cells treated with BMP4 (10 ng/mL) for indicated times. l Ratio of BMPR1A protein remaining in control and Laptm5-overexpressing Renca cells treated as in ( k ) ( n = 3 per group). m qRT-PCR analysis of Bmpr1a in control and Laptm5-overexpressing Renca cells treated with BMP4 (10 ng/mL) for indicated times. n = 3 per group. Immunoblots are representative of three biological replicates. Data in bar graphs are presented as mean ± SD. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a Differentially expressed cancer-related gene sets (C2_PATHWAYS) with high LAPTM5 expression in the TCGA KIRC cohort and KIRP cohort (Top 5). NES, normalized enrichment score. FDR q, false discovery rate q value. GSEA output of genes in the PID_BMP_Pathway by LAPTM5 high and low expression groups from the KIRC cohort ( b ) and KIRP cohort ( c ) in the TCGA database. ES, enrichment score. d IB analysis of Renca luci parental and derivative cells treated with Mock (ddH 2 O), or recombinant murine BMP4 (10 ng/mL or 20 ng/mL) for 60 min. e IHC analysis of p-Smad 1/5/8 levels in lung metastases of Renca luci . Scale bar, 50 μm. f IB analysis of control and Laptm5-overexpressing Renca cells (left panel) or control and Laptm5-silenced Renca LuM2b cells (middle and right panel) treated with BMP4 (10 ng/mL) for indicated times. g Representative images of tumor sphere assay of control and Laptm5-overexpressing Renca cells treated with or without BMP4 (30 ng/mL) for 7 days, and quantification of tumor sphere formation of indicated groups ( n = 3 per group). Scale bar, 200 μm. h Representative images of tumor sphere assay of control and Laptm5-silenced Renca LuM2b cells treated with or without DMH1 (5 μM) for 7 days, and quantification of tumor sphere formation of indicated groups ( n = 3 per group). Scale bar, 200 μm. i qRT-PCR analysis of stemness markers in indicated cells. n = 3 per group. j Semiquantitative RT-PCR analysis of BMP receptors in control and Laptm5-overexpressing Renca luci cells with Actb as control. k IB analysis of BMPR1A in control and Laptm5-overexpressing Renca cells treated with BMP4 (10 ng/mL) for indicated times. l Ratio of BMPR1A protein remaining in control and Laptm5-overexpressing Renca cells treated as in ( k ) ( n = 3 per group). m qRT-PCR analysis of Bmpr1a in control and Laptm5-overexpressing Renca cells treated with BMP4 (10 ng/mL) for indicated times. n = 3 per group. Immunoblots are representative of three biological replicates. Data in bar graphs are presented as mean ± SD. Two-tailed Student’s unpaired t -test were used for statistical analysis in all panels. Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Expressing, Recombinant, Paraffin-embedded Immunohistochemistry, Quantitative RT-PCR, Reverse Transcription Polymerase Chain Reaction, Western Blot, Two Tailed Test

a Schematic illustration of TMT-labeled LC-MS/MS analysis in 786O LAPTM5 and Renca Laptm5 cells treated or untreated with BMP4 (10 ng/mL) for 60 min. b Coomassie brilliant blue staining of 786O LAPTM5 cells treated or untreated with BMP4 (10 ng/mL) for 60 min. The arrowheads indicate bands of WWP2 and LAPTM5, respectively. c Overlap of identified LAPTM5-binding proteins in 786O LAPTM5 and Renca Laptm5 cells. d Heatmap of the nine proteins identified binding to LAPTM5 by TMT-labeled LC-MS/MS analysis. Schematic illustration ( e ) and IB result ( f ) of serial immunoprecipitation (IP) analysis using anti-Myc (first round) and anti-HA (second round) in 293T cells transfected with expression vectors for Flag-LAPTM5, HA-WWP2, and Myc-BMPR1A. Arrowhead indicates the band of HA-WWP2. g IP and IB analyses of 293T cells transfected with expression vectors for Flag-LAPTM5, HA-WWP2, and Myc-BMPR1A. h Quantitation of the binding between HA-WWP2 and Myc-BMPR1A as treated in ( g ) ( n = 3 per group). i IP and IB analyses of 786O luci/eGFP Parental and LuM1a cells. j Schematic illustration of full-length (FL) WWP2 and its deletion mutants lacking functional domains (ranges indicate amino acids present in construct). C838A represents the mutation of cytosine to adenine in the 838th nucleotide. k IP and IB analyses of 786-O cells transfected with expression vector for Flag-LAPTM5, control (Vector) or Myc-tagged full-length WWP2 or various deletion mutants. l Schematic illustration of LAPTM5, WWP2 and BMPR1A interactions in cells. m Immunofluorescence (IF) analysis of control (upper panel) and LAPTM5-overexpressing (lower panel) 786-O cells treated with Mock (ddH 2 O), or BMP4 (10 ng/mL) for 60 min or 120 min. Scale bar, 10 μm. n Quantification of BMPR1A punctate spots per 786-O cell treated as in (M) [ n = biological replicates, 6 in Vector, 4 in LAPTM5 (Mock); n = 4 in Vector, 8 in LAPTM5 (60 min); n = 3 in Vector, 9 in LAPTM5 (120 min)]. Data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. o Ratio of co-localized spots to total BMPR1A (red line) or LAPTM5 (green line) spots and quantification of co-localized spots per 786-O cell (yellow line) treated as in ( m ) ( n = 4, 8, 9 biological replicates in group Mock, 60 min, 120 min, respectively). Immunoblots are representative of three biological replicates. Data are presented as mean ± SD in ( h ), and mean ± SEM in ( o ). Two-tailed Student’s unpaired t -test was used for statistical analysis in all panels. Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a Schematic illustration of TMT-labeled LC-MS/MS analysis in 786O LAPTM5 and Renca Laptm5 cells treated or untreated with BMP4 (10 ng/mL) for 60 min. b Coomassie brilliant blue staining of 786O LAPTM5 cells treated or untreated with BMP4 (10 ng/mL) for 60 min. The arrowheads indicate bands of WWP2 and LAPTM5, respectively. c Overlap of identified LAPTM5-binding proteins in 786O LAPTM5 and Renca Laptm5 cells. d Heatmap of the nine proteins identified binding to LAPTM5 by TMT-labeled LC-MS/MS analysis. Schematic illustration ( e ) and IB result ( f ) of serial immunoprecipitation (IP) analysis using anti-Myc (first round) and anti-HA (second round) in 293T cells transfected with expression vectors for Flag-LAPTM5, HA-WWP2, and Myc-BMPR1A. Arrowhead indicates the band of HA-WWP2. g IP and IB analyses of 293T cells transfected with expression vectors for Flag-LAPTM5, HA-WWP2, and Myc-BMPR1A. h Quantitation of the binding between HA-WWP2 and Myc-BMPR1A as treated in ( g ) ( n = 3 per group). i IP and IB analyses of 786O luci/eGFP Parental and LuM1a cells. j Schematic illustration of full-length (FL) WWP2 and its deletion mutants lacking functional domains (ranges indicate amino acids present in construct). C838A represents the mutation of cytosine to adenine in the 838th nucleotide. k IP and IB analyses of 786-O cells transfected with expression vector for Flag-LAPTM5, control (Vector) or Myc-tagged full-length WWP2 or various deletion mutants. l Schematic illustration of LAPTM5, WWP2 and BMPR1A interactions in cells. m Immunofluorescence (IF) analysis of control (upper panel) and LAPTM5-overexpressing (lower panel) 786-O cells treated with Mock (ddH 2 O), or BMP4 (10 ng/mL) for 60 min or 120 min. Scale bar, 10 μm. n Quantification of BMPR1A punctate spots per 786-O cell treated as in (M) [ n = biological replicates, 6 in Vector, 4 in LAPTM5 (Mock); n = 4 in Vector, 8 in LAPTM5 (60 min); n = 3 in Vector, 9 in LAPTM5 (120 min)]. Data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. o Ratio of co-localized spots to total BMPR1A (red line) or LAPTM5 (green line) spots and quantification of co-localized spots per 786-O cell (yellow line) treated as in ( m ) ( n = 4, 8, 9 biological replicates in group Mock, 60 min, 120 min, respectively). Immunoblots are representative of three biological replicates. Data are presented as mean ± SD in ( h ), and mean ± SEM in ( o ). Two-tailed Student’s unpaired t -test was used for statistical analysis in all panels. Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Labeling, Liquid Chromatography with Mass Spectroscopy, Staining, Binding Assay, Immunoprecipitation, Transfection, Expressing, Quantitation Assay, Functional Assay, Construct, Mutagenesis, Plasmid Preparation, Immunofluorescence, Whisker Assay, Western Blot, Two Tailed Test

a IP and IB analyses of 786-O cells transfected with expression vectors for His-WWP2, Myc-BMPR1A and HA-ubiquitin (Ub). b IP and IB analyses of 786-O cells transfected with expression vectors for His-tagged wild type (wt) or C838A mutated WWP2, Myc-BMPR1A and HA-Ub. c IP and IB analyses of 786-O cells transfected with siRNAs against WWP2 or expression vectors for Myc-BMPR1A and HA-Ub. d IP and IB analyses of 786-O cells transfected with expression vectors for Flag-LAPTM5, His-WWP2, Myc-BMPR1A, HA-Ub and treated with different concentrations of chloroquine (CQ) for 60 min. e Representative H&E images of lung metastases at 21 days after I.V. injection of Renca cells stably expressing Laptm5 and/or Bmpr1a (left panel) and quantification of the lung metastatic lesions per slide (right panel, n = 8 mice per group). Data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test was used for statistical analysis. Immunoblots are representative of three biological replicates. Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a IP and IB analyses of 786-O cells transfected with expression vectors for His-WWP2, Myc-BMPR1A and HA-ubiquitin (Ub). b IP and IB analyses of 786-O cells transfected with expression vectors for His-tagged wild type (wt) or C838A mutated WWP2, Myc-BMPR1A and HA-Ub. c IP and IB analyses of 786-O cells transfected with siRNAs against WWP2 or expression vectors for Myc-BMPR1A and HA-Ub. d IP and IB analyses of 786-O cells transfected with expression vectors for Flag-LAPTM5, His-WWP2, Myc-BMPR1A, HA-Ub and treated with different concentrations of chloroquine (CQ) for 60 min. e Representative H&E images of lung metastases at 21 days after I.V. injection of Renca cells stably expressing Laptm5 and/or Bmpr1a (left panel) and quantification of the lung metastatic lesions per slide (right panel, n = 8 mice per group). Data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test was used for statistical analysis. Immunoblots are representative of three biological replicates. Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Transfection, Expressing, Injection, Stable Transfection, Whisker Assay, Two Tailed Test, Western Blot

a Representative IHC images for LAPTM5 in clinical sections of normal kidney tissue, primary RCC tissue, lung metastases (Lung met.), bone metastases (Bone met.) and brain metastases (Brain met.) from RCC patients. Scale bar, 100 μm. b IHC staining score of LAPTM5 in clinical primary RCC and organ metastases from RCC patients. Normal, n = 106 samples; Primary RCC, n = 150 samples; Lung met., n = 10 samples; Bone met., n = 22 samples; Brain met., n = 2 samples. c IHC images for BMPR1A in clinical sections [Serial section of ( a )] of lung metastases (Lung met.), bone metastases (Bone met.) and brain metastases (Brain met.) from RCC patients. Scale bar, 100 μm. d Pearson correlation between LAPTM5 and BMPR1A levels in clinical RCC metastases. R , Pearson correlation coefficient; center line, mean of best-fit line; the shadow indicates 95% confidence interval. e IHC staining score of LAPTM5 in primary RCC patients with lung metastases (with lung met., n = 31 samples) and those without lung metastases (no lung met., n = 119 samples). f Univariate and multivariate analyses to determine risk factors associated with lung metastasis of RCC patients ( n = 150 patients). Cl: confidence interval. Kaplan–Meier survival curves for overall survival ( g ) and metastatic-free survival ( h ) of patients with low and high LAPTM5 mRNA level in the TCGA KIRC cohort. i Schematic illustration of LAPTM5 promoting lung-specific metastasis of RCC. CQ, chloroquine; P, phosphorylated; U, ubiquitylated. In b and e , the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test in ( b ) and ( e ). Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a Representative IHC images for LAPTM5 in clinical sections of normal kidney tissue, primary RCC tissue, lung metastases (Lung met.), bone metastases (Bone met.) and brain metastases (Brain met.) from RCC patients. Scale bar, 100 μm. b IHC staining score of LAPTM5 in clinical primary RCC and organ metastases from RCC patients. Normal, n = 106 samples; Primary RCC, n = 150 samples; Lung met., n = 10 samples; Bone met., n = 22 samples; Brain met., n = 2 samples. c IHC images for BMPR1A in clinical sections [Serial section of ( a )] of lung metastases (Lung met.), bone metastases (Bone met.) and brain metastases (Brain met.) from RCC patients. Scale bar, 100 μm. d Pearson correlation between LAPTM5 and BMPR1A levels in clinical RCC metastases. R , Pearson correlation coefficient; center line, mean of best-fit line; the shadow indicates 95% confidence interval. e IHC staining score of LAPTM5 in primary RCC patients with lung metastases (with lung met., n = 31 samples) and those without lung metastases (no lung met., n = 119 samples). f Univariate and multivariate analyses to determine risk factors associated with lung metastasis of RCC patients ( n = 150 patients). Cl: confidence interval. Kaplan–Meier survival curves for overall survival ( g ) and metastatic-free survival ( h ) of patients with low and high LAPTM5 mRNA level in the TCGA KIRC cohort. i Schematic illustration of LAPTM5 promoting lung-specific metastasis of RCC. CQ, chloroquine; P, phosphorylated; U, ubiquitylated. In b and e , the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test in ( b ) and ( e ). Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Immunohistochemistry, Whisker Assay, Two Tailed Test

a Double clustering heatmap of top 20 up- and down-regulated genes in breast cancer (BCa) cells with lung metastatic activity (Lung-M, n = 5 cell lines) compared with populations with mediate activity (Mediate, n = 11 cell lines) and bone metastatic activity (Bone-M, n = 5 cell lines) in the GSE1206 dataset. b LAPTM5 counts in BCa cells with mediate (Mediate, n = 11), lung metastatic (Lung-M, n = 5) and bone metastatic (Bone-M, n = 5) activity in the GSE1206 dataset. c LAPTM5 expression in brain ( n = 27 samples), lung ( n = 4 samples), liver ( n = 2 samples), bone ( n = 1 sample), other organs ( n = 9 samples) and lymph node ( n = 9 samples) metastases from melanoma in the GSE50496 dataset. d LAPTM5 expression in primary tumors (n = 186 samples), lung ( n = 20 samples) and liver ( n = 47 samples) metastases from colorectal cancer in the GSE41258 dataset. e IB analysis of control and Laptm5-overexpressing or control and Laptm5-silenced 4T1 luci cells. Immunoblots are representative of three biological replicates. f Schematic illustration for the mammary pad cell inoculation, in situ tumor measurement and lung metastases detection using the murine 4T1 breast cancer cell line. g Tumor volumes of control and Laptm5-silenced 4T1 luci cells inoculated in situ as described in ( f ). n = 10 mice per group. The data represent the mean ± SEM. h Representative IHC images of luciferase staining in lung sections harvested from mice treated as in ( f ). Scale bar, 50 μm. i Quantification of metastases per lung section at 24 days after mammary pad injection in each group ( n = 5 mice per group). In b , c , d , and i , the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test was used for statistical analysis in all panels. Source data are provided as a Source data file.

Journal: Nature Communications

Article Title: Lysosomal protein transmembrane 5 promotes lung-specific metastasis by regulating BMPR1A lysosomal degradation

doi: 10.1038/s41467-022-31783-6

Figure Lengend Snippet: a Double clustering heatmap of top 20 up- and down-regulated genes in breast cancer (BCa) cells with lung metastatic activity (Lung-M, n = 5 cell lines) compared with populations with mediate activity (Mediate, n = 11 cell lines) and bone metastatic activity (Bone-M, n = 5 cell lines) in the GSE1206 dataset. b LAPTM5 counts in BCa cells with mediate (Mediate, n = 11), lung metastatic (Lung-M, n = 5) and bone metastatic (Bone-M, n = 5) activity in the GSE1206 dataset. c LAPTM5 expression in brain ( n = 27 samples), lung ( n = 4 samples), liver ( n = 2 samples), bone ( n = 1 sample), other organs ( n = 9 samples) and lymph node ( n = 9 samples) metastases from melanoma in the GSE50496 dataset. d LAPTM5 expression in primary tumors (n = 186 samples), lung ( n = 20 samples) and liver ( n = 47 samples) metastases from colorectal cancer in the GSE41258 dataset. e IB analysis of control and Laptm5-overexpressing or control and Laptm5-silenced 4T1 luci cells. Immunoblots are representative of three biological replicates. f Schematic illustration for the mammary pad cell inoculation, in situ tumor measurement and lung metastases detection using the murine 4T1 breast cancer cell line. g Tumor volumes of control and Laptm5-silenced 4T1 luci cells inoculated in situ as described in ( f ). n = 10 mice per group. The data represent the mean ± SEM. h Representative IHC images of luciferase staining in lung sections harvested from mice treated as in ( f ). Scale bar, 50 μm. i Quantification of metastases per lung section at 24 days after mammary pad injection in each group ( n = 5 mice per group). In b , c , d , and i , the data are presented as whisker plots: midline, median; box, 25–75th percentile; whisker, minimum to maximum values. Two-tailed Student’s unpaired t -test was used for statistical analysis in all panels. Source data are provided as a Source data file.

Article Snippet: TET-inducible Flag-Laptm5/Control lentivirus were obtained from GeneChem (Shanghai, China).

Techniques: Activity Assay, Expressing, Western Blot, In Situ, Luciferase, Staining, Injection, Whisker Assay, Two Tailed Test